Answers.com > Wiki Answers > Categories > Science > Biology > How do you transcribe ATGATTGTGAGGCTGCCCTTTTGGTAG to mRNA sequence?

How do you transcribe ATGATTGTGAGGCTGCCCTTTTGGTAG to mRNA sequence?

Answer:
The DNA sequence of 5' ATG ATT GTG AGG CTG CCC TTT TGG TAG 3' would, in mRNA, become 3' UAC UAA CAC UCC GAC GGG AAA ACC AUC 5'
First answer by Blue. Last edit by Blue. Contributor trust: 2481 [recommend contributor recommended]. Question popularity: 1 [recommend question].

Can you answer these Biology questions?

What membrane protein serves as the cell marker? Answer it!
What are good shade plants? Answer it!
What organisms uses cellular respiration to obtain energy? Answer it!
Where did Antoine Lavoisier worked? Answer it!
How are palisade cells adapted for photosynthesis? Answer it!

Relevant answers:

Related topics:

Home

Answer these

Did President Roosevelt and President Truman do good things for the war?
In: US in WW2
Answer it!
How long does it take for Russel Howard to realize his hear is on fire?
In: Comedy TV Shows
Answer it!
What is the third book of the red pyramid?
In: Kane Chronicles
Answer it!
Where do you find the wizard in harmonica town on harvest moon animal parade?
In: Nintendo DS
Answer it!
» more

Featured guides

» More