Search results
Answered questions with 'g_g_g_g_g_gggg' in all categories.
|
Displaying 50 results per page
What is your relationship if someones g g g grandad is the brother of your g g uncle?
hes distantly related to you
In: Germany in WW2 | Algebra
What is the DNA replacation for t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?
a a g c t c t g a a t c a g c c t a c a c t t c a c c a c t a a.T, which stands for Thymine, only "goes" with A (Adanine). C,...
In: Biology | Zoology or Animal Biology | Genetics
What does the G stand for in penicillin G?
penicillin G stands for the phrase gold standard, as in gold standard penicillin.
What is a hard g and a soft g?
hard g: g as in "guess" soft g: g as in "edge"The word egregious, for instance, contains a hard g (first) and a soft g (second)
I.G.G.Y. stands for:I'm Gonna Get Ya because he likes to eat/get your computer's keyboard mouse!!
In: Moshi Monsters
How do you pronounce g As g or j?
Depending on their language of origin, and common usage, G can have either sound. One general rule is that the G followed by an...
What does ''G'' stand for in G MAIL?
It stands for "google", because it's owned by google. So, it's like googlemail.
In: Uncategorized
What does the g stand for in g mail?
It stands for "google", because it's owned by google. So, it's like googlemail.
In: Uncategorized
What does the G stand for in G-SHOCK?
So the G is most likely Gravity as is the G in G-Force. They were designed to take a bit more punishment than other watches,...
In: Uncategorized
What is the g in g-string stand for?
Theory One: It's short for "girdle string." The first known reference to the item was found in J.H. Beadles' Western Wilds...
In: Clothing | Scattergories Words Starting with Certain Letters
GTG generally means, Got To Go, but so does G2G.
It's a band which is known in Lithuanian hip-hop scene for 7 years alredy. In the begining there were 2 mc's (Svaras & Giga)...
a G is the force due to gravity. 2G would be twice the force due to gravity. Astronauts have to withstand multiple G when leaving...
In: Music | Physics | Earth Sciences
How do you replicate t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?
it is aagctctgaatcagcctacacttcaccactaa if you are looking for the base pairs
In: Biology | Zoology or Animal Biology | Genetics
What is t a c g c c g t g g t t c g a t c?
t a c g c c g t g g t t c g a t c is an example of a DNA code. inside each cell in your body there is a doublr helix of DNA Each...
What is the range for the following set of measurements 7.1 g 9.8 g 2.3 g 8.5 g 7.4 g5.7 g?
2.3 g to 9.8g
Haarlem g feyenoord g psv g ac milan g sampdoria g Chelsea?
The great Ruud Gullit
In: Soccer History | English Football | International Football
Who transferred from Liverpool g Leeds g Man City g Liverpool g Cardiff City g Blackburn?
Robbie Fowler
Where are all the g and g cards in bully?
one is in th girls dorm in the atticone is if you go to the gym and take a left go up the first set of ladders and jump left you...
In: Bullying
What is the answer to 48 g 19 mg to g?
The answer is 0000.067000 weird but true
Why is the g clef called the g clef?
The swirl in the bottom half of the clef cirlces around the G line of the clef. It also looks a bit like a G.
Is G to G flat a minor octave?
No, it's a diminished octave. There is no such thing as a minor octave.
What is 2547 g how many kg and g?
2,547g is equal to how many kg?
Hard G. An example of a soft G would be the G in the word 'genre'.
What G stands for in Ellen G White?
The G in Ellen White's name stand for Gould so it is Ellen Gould White.
Words that begin with g and end with g?
Gang Gag Gripping Griping Grappling Many more! You can simply take a verb that starts with 'g' and change it to its present tense...
What word starts with G ends with G?
Going, growing, gong, grading, gag, gagging, pretty much any verb that starts with G and just add ing
In: Word Games | Scattergories Words Starting with Certain Letters
