0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
The codon GAU is for?
GAU is the codon.
What anticodon pairs with the codon gau?
The anticodon would be CUA
Which anticodon pairs with gau?
The answer is AUC. Anti codons follow regular base-pairing rules, but they are also mirrored horizontally. Standard base pairing would dictate the answer be CUA, but anti codon is instead AUC. The previous answer was misleading and incorrect.
How many bases are in an anti-codon?
3 bases make up an anti-codon, 3 bases also make up a codon
Complementary of a codon?
anti-codon.
How is genetic code used to make proteins?
There are twenty amino acids in proteins, three bases in a codon and three bases in an anti-codon newly known as an anti-sense codon. If the codons make up mRNA , then the anti-sense codons are found in the transfer RNAs. A triplet codon corresponds to an amino acid. Adenine pairs with Uracil, and Guanine Pairs with Cytosine. Let's say we had a mRNA strand like: AUACGUACGUACGUCACGUGAUGCUACACCUGACAUCCGAUCAUGAGUCGAUCAUGAUGA (oops, there's no more) The first codon is AUA. The anti-codon UAU, would attach to it. AUA corresponds to the amino acid Tyrosine. Then the next anti-codon GCA would attach to the second codon CGU. Arginine corresponds to the codon CGU. Tyrosine would join together with Arginine. The bond of the Tyrosine and its tRNA breaks. This is all done by a ribosome. The process continues until the chain is complete.
Which anticondon pairs with the condon gau?
CUA
MRNA has codons or anti codons?
Great Question. The triplet Codon, as represented by the sequence of Dna bases, would appear to be inverted into anti-Codon form in the mRna molecule. This makes the triplet Codon on the transfer-Rna Codon form.
How many base pairs make up a codon?
One codon is made up of three base pairs.
What is codon recognition?
Short Answer is: for every triplet codon there is a recognizable anti-triplet codon.
What is the difference between a coden and an anti coden?
a codon is the sequence of three nucleotides of mRNA, the anti codon is the amino acid of tRNA that is matched to the codon.
In which molecule would you find an anti-codon?
an anti-codon is a code for an amino acid found on protein
