0
Yes, strands of DNA are complementary. Complementary implies that a sequence of nucleotides (ex. ATATG) is ordered in a way that it directly corresponds to another sequence of nucleotides (ex. TATAC). Since DNA is double stranded in most circumstances, barring mutagenesis, one strand would be pair with its complementary strand, thus forming the double stand.
Wiki User
∙ 12y ago
Wiki User
∙ 15y agoA complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
Wiki User
∙ 14y agoIn DNA, a complementary strand is the strand that matches and binds to the other side of the said DNA.
Wiki User
∙ 12y agoEach DNA base bonds with a certain one on the other strand. A binds to T, and C binds to G.
This means the complementary sequence of ATCGGTAC is TAGCCATG.
Wiki User
∙ 14y agoC and G A and T
Wiki User
∙ 14y agoA copy of a region of a strand of DNA
Add your answer:
Earn +20 pts
Given the following strand of dna what is the complementary strand actggctac?
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
What is the complementary DNA strand of CCTAGCT?
GGATCGA is comlementary to the DNA strand CCTAGCT.
What does the reaction in the test tube generate when complementary DNA is made for reading DNA?
When a complementary strand and a coding strand are combined in a test tube the result is a recombinant DNA strand.
What is the complementary DNA strands?
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
What is the complementary DNA strand for atgtatcggatccatgtataa?
TACATAGCCTAGGTACATATT
Given the following strand of dna what is the complementary strand actggctac?
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
What is complementary DNA strand for att-cga-tgc?
The complementary strand of the DNA is TAA-GCT-ACG
What is the complementary DNA strand template strand of atgccatgg?
The complementary DNA strand template of ATGCCATGG is the basic design structure. It determines how the DNA strand will be constructed and the process in which it is formed.
What strand of DNA is use to make a complementary copy or to make a complementary mRNA molecule?
The template strand is used to make a complementary copy. This is a type of DNA strand.
What is the complementary DNA?
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
What is the complementary DNA strand of CCTAGCT?
GGATCGA is comlementary to the DNA strand CCTAGCT.
What does the reaction in the test tube generate when complementary DNA is made for reading DNA?
When a complementary strand and a coding strand are combined in a test tube the result is a recombinant DNA strand.
What is the complementary DNA strands?
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
When a strand of DNA is ATCG what would the complementary pairings be for the replicated strand of DNA?
TAGC.
Transcription makes a complementary strand of the DNA?
This Process Is Called DNA Transcription. *Apex*
Complementary strand of DNA for gene segment gccaatgct?
The complementary DNA strand is CGTTTGATGG. A pairs with T, and G pairs with C.
What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?
The strand is called the parental strand. the gene being copied would depend on which protein is needed.
