0
What would be the sequence of the complimentary DNA strand for this gene atc gtt aac gca?
Wiki User
∙ 10y ago
The complementary base of A is T, and the complementary base of G is C. So if there is an T the complementary would be A, and if there is a C the complementary would be a G and so on. Therefore the complementary strand would be: G A A T C C G A A T G G T.
Wiki User
∙ 14y ago
Wiki User
∙ 15y agoUAG GCA AUA CAU GGU btw, I got 100% on the ce.byu.edu speedback
Wiki User
∙ 15y agoThe complementary DNA strand would be TAC CAG GAC GCG.
Wiki User
∙ 11y agogcctaatccgtatggccggtatcatca
cggattaggcataccggccatagtagt
these are the complement strands of eachother.
Wiki User
∙ 15y agoaug uac cgc auc cau auu uag
Wiki User
∙ 12y agogaatccgaatggt
Wiki User
∙ 11y agoCTAGGTACTCAATG
Add your answer:
Earn +20 pts
What allows a DNA probe to find a single-stranded target gene?
Diploid cells
What is the section of DNA being used to make the strand of RNA known as?
The DNA template strand is used to create mRNA.
Why is it important to know a gene sequence?
what is a practical or clinical use of knowing the base sequence of a gene
Why are two different primers required for the polymerase chain reaction?
Must use the forward and reverse primers to bind to complementary sequence at the 3' end of the template strand - each NEW strand is built in 5' to 3' direction. They flank the targeted gene region - must attach one to each strand of the target DNA.
What makes alleles of the same gene different from each other?
A gene consists of a specific sequence of bases; variations in that sequence make for a different gene.
What is strand of DNA that codes for a specific trait?
A gene is a strand of DNA that codes for a specific trait
What is a linear stretch of DNA that specifies the sequence of amino acids in a polypeptide?
A linear stretch of DNA that specifies the sequence of amino acids in a polypeptide is called a gene. The primary function of DNA ligase is to seal new short stretches of nucleotides into one continuous strand.
The first stage of gene expression is called?
The first stage of gene expression is known as transcription. This is the process by which RNA Polymerase, along with other transcription factors, reads and transcribes the DNA sequence into a complementary RNA strand.
What is the effects of mutation?
A mutation is a permenent in DNA sequence of a gene,mutation in a gene's DNA sequence can alterthe aminoacid sequence of the protein encodedby the gene.
What allows a DNA probe to find a single-stranded target gene?
Diploid cells
What is the section of DNA being used to make the strand of RNA known as?
The DNA template strand is used to create mRNA.
A mutation is a change in a?
gene sequence
Why is it important to know a gene sequence?
what is a practical or clinical use of knowing the base sequence of a gene
What is the different between a chromosome and a gene?
A Chromosome is a threadlike linear strand of DNA and associated proteins in the nucleus of eukaryotic cells that carries the genes and functions in the transmission of hereditary information. It is a circular strand of DNA in bacteria that contains the hereditary information necessary for cell life.As appose to a Gene A hereditary unit consisting of a sequence of DNA that occupies a specific location on a chromosome and determines a particular characteristic in an organism. Genes undergo mutation when their DNA sequence changes.
What is the difference between a chromosome and a gene?
A Chromosome is a threadlike linear strand of DNA and associated proteins in the nucleus of eukaryotic cells that carries the genes and functions in the transmission of hereditary information. It is a circular strand of DNA in bacteria that contains the hereditary information necessary for cell life.As appose to a Gene A hereditary unit consisting of a sequence of DNA that occupies a specific location on a chromosome and determines a particular characteristic in an organism. Genes undergo mutation when their DNA sequence changes.
Why are two different primers required for the polymerase chain reaction?
Must use the forward and reverse primers to bind to complementary sequence at the 3' end of the template strand - each NEW strand is built in 5' to 3' direction. They flank the targeted gene region - must attach one to each strand of the target DNA.
Is the given strand of DNA a coding or non coding strand tcctttctcattcagaggccgaac.This portion is removed from the center of the gene Why?
According to me,when this strand is transcribed the mRNA formed is not coding for any mino acid that is why this portion of gene is removed from DNA.
